sgRNA Cloning and CRISPR Plasmid Preparation
This process involves the following steps, which can be completed in a week:
  1. Determining target oligo sequence and ordering 25nmoles of each forward and reverse oligo.
  2. Preparing annealed oligos.
  3. Golden gate reaction to clone annealed oligos into vector/backbone (px330 used below).
  4. Transformation of Golden Gate reaction products into competent cells and screening clones for sgRNA containing vector.
  5. Maxi/midiprep clones with correct sgRNA sequence for CRISPR transfection.
Preparation of Annealed Oligos (100µl):
After lyophilized oligos are received proceed as follows:
  • Short spin down tubes (10s at max speed)
  • Resuspend oligos with nuclease-free dH2O at 100µM (#nMoles x 10 µl of water)
  • Prepare annealed oligos below:
    ComponentVolume(µl)
    NEB buffer 2 10
    100µM Forward oligo 1
    100µM Reverse oligo 11
    Nuclease-free water (1X) 88
  • Place tubes in boiling water (100ºC) for 5 minutes and then remove bath from heat and allow to cool down to room temperature.
Golden Gate Reaction (5µl):
  • In 200µl PCR ready tubes prepare the reactions for each annealed sgRNA oligo set as below, a master mix can be made to reduce pipetting errors:
    ComponentVolume(µl)
    10X Tango buffer 0.5
    0.01M DTT 0.5
    10mM ATP 0.5
    T7 ligase 0.125
    BbsI 0.25
    Annealed oligos 0.5
    Vector (px330 or other) 0.25
    Nuclease-free water 2.375
  • Place the reactions in a thermal cycler with a heated lid. Cycling conditions listed below:
    StepTemperatureTime
    7 cycles 37ºC 5 minutes
    23ºC 5 minutes
    Hold at 16ºC
Transformation:
  • Transform 1µl Golden Gate reaction products in 10ul of competent bacteria (thawed on ice and aliquoted into cold tubes)
  • Spread onto prewarmed LB agar plates with selection antibiotic. (Ampicillin 50-100µg/ml)
Validation:
  • Select single clones from LB Agar culture plates and set up overnight liquid cultures (4ml LB + Ampicillin 50-100µg/ml).
  • Make minipreps from overnight cultures and send for sequencing using U6-sequencing primer
U6-seq2: ACTATCATATGCTTACCGTAAC