sgRNA Cloning and CRISPR Plasmid Preparation
This process involves the following steps, which can be completed in a week:
- Determining target oligo sequence and ordering 25nmoles of each forward and reverse oligo.
- Preparing annealed oligos.
- Golden gate reaction to clone annealed oligos into vector/backbone (px330 used below).
- Transformation of Golden Gate reaction products into competent cells and screening clones for sgRNA containing vector.
- Maxi/midiprep clones with correct sgRNA sequence for CRISPR transfection.
Preparation of Annealed Oligos (100µl):
After lyophilized oligos are received proceed as follows:
- Short spin down tubes (10s at max speed)
- Resuspend oligos with nuclease-free dH2O at 100µM (#nMoles x 10 µl of water)
- Prepare annealed oligos below:
Component Volume(µl) NEB buffer 2 10 100µM Forward oligo 1 100µM Reverse oligo 11 Nuclease-free water (1X) 88 - Place tubes in boiling water (100ºC) for 5 minutes and then remove bath from heat and allow to cool down to room temperature.
Golden Gate Reaction (5µl):
- In 200µl PCR ready tubes prepare the reactions for each annealed sgRNA oligo set as below, a master mix can be made to reduce pipetting errors:
Component Volume(µl) 10X Tango buffer 0.5 0.01M DTT 0.5 10mM ATP 0.5 T7 ligase 0.125 BbsI 0.25 Annealed oligos 0.5 Vector (px330 or other) 0.25 Nuclease-free water 2.375 - Place the reactions in a thermal cycler with a heated lid. Cycling conditions listed below:
Step Temperature Time 7 cycles 37ºC 5 minutes 23ºC 5 minutes Hold at 16ºC
Transformation:
- Transform 1µl Golden Gate reaction products in 10ul of competent bacteria (thawed on ice and aliquoted into cold tubes)
- Spread onto prewarmed LB agar plates with selection antibiotic. (Ampicillin 50-100µg/ml)
Validation:
- Select single clones from LB Agar culture plates and set up overnight liquid cultures (4ml LB + Ampicillin 50-100µg/ml).
- Make minipreps from overnight cultures and send for sequencing using U6-sequencing primer
U6-seq2: ACTATCATATGCTTACCGTAAC